31 December 2012

Bests of 2012

I had a lot of amazing experiences this year. Since this blog is supposed to be a book blog, those will go first.

Books: 
   New to Me:
   Graphic Novels:
  • The Unwritten Vol. 6: Tommy Taylor and the War of Words
  • Astonishing X-men Torn and Unstoppable
  •  American Vampire Volume 3
   Re-Read:
  • The Shining by Stephen King
  • The Sweetness at the Bottom of the Pie by Alan Bradley
  • The Hitchhiker's Guide to the Galaxy by Douglas Adams
  • The Graveyard Book by Neil Gaiman
  • Good Omens by Neil Gaiman and Terry Pratchett



Movies:
I know I'm genre heavy, I'm a nerd :)
  • The Avengers!
  • Moonrise Kingdom
  • The Dark Knight Rises
  •  Cloud Atlas
  • The Woman in Black
  • The Cabin in the Woods
  • Silver Linings Playbook

Life, not least important though it is coming last:  
  • We got Married!  maybe i should have put this at the very top of the post,
  • Having all our family and friends meet and get along so well!
  • We bought a house!  I never got around to posting about it but Ben and I bought a house at the end of August.   
  • Shakespeare in the Park did Much Ado About Nothing and it was wonderful
  • Seeing Neil deGrasse Tyson speak at Vanderbilt
  • Learning everything there is to know about competitive swimming while watching the Olympics with B.
  • Finishing my 3rd semester of my Master's with some great classes.
So that's a bit of the highlights of my year.  I hope everyone had a good 2012 and has a wonderful New Year!  Be Safe!
 

30 December 2012

Final Tally!

I don't believe I will finish anything in the next 30ish hours so here's my final tally for 2012.

Total books read in 2012: 66
Library books: 53
Non-fiction: 13
Audio: 20
Graphic Novels: 16

For Challenges:

Non-fiction Non-memoir challenge: 6
Science Book Challenge: 2
Chunkster: 2 (i've read plenty of longer books but they've been on audio)
RIP: 4
Total pages for the End of the World Challenge:  13652 (doesn't count rereads or graphic novels)

so...these are my lowest totals since I started recording.  I mean, if you pull out the graphic novels, which usually i can read in an hour or less, I read less than a book a week.  Factor in that 20 were audio books, which i listen to while going to and from work, and i'm basically at a book every two weeks.  now, I did have a pretty busy year, so that's an excuse.  I do miss reading and blogging like I used to though, so my goal/resolution is to get back into the habit.  I did reread several books this year which i found to be quite nice, so perhaps I should focus on rereads?  Also, Librarything says i have about 150 unread books so i need to work on those too.  I have signed up for the TBR Double Dare to help!  I'll be posting my bests list tomorrow.  



 ***Update***
I forgot to add Dracula in!  I listened to it on audio and finished the last chapters last week at work.  It was a reread, so the total, library and audio totals need to be 67, 54 and 21!

 

29 December 2012

The Last Policeman and Tokyo Year Zero

I got through two murder mysteries this week.  

I read The Last Policeman by Ben H. Winters last weekend.  Actually, I read it Saturday evening between 5-9 pm.  Superfast reads seem to be something i can only do with mysteries. There's just something about them that i feel almost compelled as I read them.  They don't have to be actiony thrillers even; I can do the same thing with Agatha Christie or Dorothy Sayers (who i need to read more of).  anyway, in The Last Policeman, a humanity destroying asteroid is headed to Earth, scheduled to hit about 6 months after the story begins.  We get the backstory of the asteroid's discovery as the mystery continues.  Hank Palace is a newly promoted police detective, a position he's wanted his whole life.  Unfortunately, he mainly spends his time clearing suicide scenes as many people have chosen to kill themselves rather than waiting for the asteroid.  He begins to investigate an apparent suicide because it just doesn't feel right to him and he believes it is actually a murder.  I liked the story because I liked Hank Palace and his struggles.  I liked it less when i found out that this book is the first of a trilogy.  Why aren't there more standalone genre stories anymore?  a 6



Ever try to remember what made you pick up a book?  I am wracking my brain trying to figure out why I put Tokyo Year Zero by David Peace on my library hold list.  He's not an author I've read before.  I don't read a bunch of mysteries.  While I'm interested in Japan, where the book takes place, I do not think I've read anything set in post-WWII Japan.  So I really do not know why I requested it.  This book is about a Japanese detective taking part in an investigation of a serial killer.  It wasn't a bad book but is written in a semi-stream of consciousness style that took a bit to get used to. It is also the first in a trilogy but no sci-fi theme to this one.  a 4 from me.

I gotta read something upbeat!  I am trying to read The Casual Vacancy but it is also a pretty big downer.  hmmmmmm.

15 December 2012

Quiet Or Why Introverts Rock!

I finished Susan Cain's Quiet: The Power of Introverts in a World That Can't Stop Talking. It is really very good.  It's a book that is partially written for extroverted people who want to learn about introverted ones;  there's some good bits about raising children who are introverted and about being the boss of introverts.  It is also partially a book for introverts who want to know about ourselves and why we act the way we do.  I think both parts are what make the book work.  Some of the parenting bits really just come down to "let your kid be themselves and don't overschedule" which seems like good advice for every parent and other parts are about introducing new experiences and such.  The science regarding the brain and nervous systems was fascinating and well worth reading.  a 6!


on a personal note, i'm an introvert who is more toward the middle of the extro/intro scale.  There are things that trigger my introversion more, like showing up too early for something and having to wait by myself, but I like going out and being with people more than my husband or my best friend seem to.  One thing that working on my MLIS has made me do is work on my "cold calling" issues as i've had to set up a school visit and a few other things, so that is good.  I was also a little shocked regarding how schooling is organized now, which Cain touches on in the "raising introverted kids" part of the book.  Apparently it is set up more for group activities and shared work than when i was a kid and i would have HATED that.  Partly because I learn by reading and by writing, partly because (and i really hate how braggy and arrogant this bit sounds) I was usually a little ahead of everyone in school, and partly because I always hated slackers which always happens in groups of more than like 3. She mentions that things may be starting to pull back a little from the "group is best" mindset so hopefully if i ever have a kid in school it won't be too bad for them.

13 December 2012

BTT for 12/13/12

Here's the question:

btt button

So … you’ve just finished reading a book. For the sake of the discussion, we’ll say it was everything a book should be—engaging, entertaining, interesting, thought-provoking. The kind you want to gush over. The question is—do you immediately move on to your next book? Or do you take time to contemplate this writerly masterpiece and all its associated thoughts/emotions/ideas for a while first?

So, it depends on when i finish and in what sort of mood i am in.  Occasionally, i'll hop right up and get on here and start blogging about why the book is so good. If i finish it because i stayed up too late, then i'll probably just head off to sleep.   if i'm in a reading mood then i might just take a moment or two then grab the next (or usually just the other concurrent) book.  I might grab my husband and start jabbering about how awesome it was and what it was about and whether he might like it too.  so really, there are several different ways i might handle it.  One thing i did as a kid but don't anymore is turn to the beginning and start again!  Not sure why I don't do that now; perhaps because there is so much more to read?

10 December 2012

Tommy Taylor and Cinderella

a couple of quick reviews.

AMAZING!  I finished The Unwritten Vol. 6: Tommy Taylor and the War of Words by Peter Carey and Mark Gross.  Everything really comes together and makes all the previous books really worth the read.  While the story is pretty much in no way like Gaiman's Sandman series, it has a similar sort of fun in finding and recognizing the allusions and characters plucked from history and literature.  7

Good!  I also read Cinderella: Fables are Forever by Chris Roberson and Bill Willingham.  If you've read any Fables, you may know that in that world, Cinderella is a spy/secret agent for Fabletown.  Her cover is that she owns a shoe store and is a shopaholic and therefore travels around the world for her work/hobby.  This book is the 2nd collection of her solo adventures and I liked it.  I really liked the villain in the piece as well.  a 5.  

08 December 2012

Nonbeliever Nation

I finished Nonbeliever Nation: The Rise of Secular Americans by David Niose.   Niose is the president of the American Humanist Association.  I read a bit of atheist non-fiction and follow several blogs so a lot of the info was not necessarily new to me.  If you don't follow atheist news and are curious about those end of the year polls that came out, talking about how the categories of "nones" or "spiritual but not religious" are rising, I can definitely recommend this book.  If you read a lot of atheist news, much of the info is not new but it was an interesting read nonetheless.  Niose collates a lot of data and shows how changing demographics are creating a more secular America.  He also details some of the court cases recently and describes the new tack of pursuing cases based on non-discrimination laws rather than freedom of religion.  a 5 from me only because i've read a lot of this before. 

29 November 2012

The Shining ReRead

The Shining by Stephen King was a book i first read far too young. I was probably 12 or so when I first read it and definitely gave myself a few frights.  Also probably learned more about sex than i should have known at that point as well.  I decided to listen to it this time rather than read the paper version.

The book was scary to me in a whole new way on this reread.  While I've read it several times, I know i probably have not read it in the last 10 years, so I haven't read it while involved in a serious adult relationship, or while living with someone.  On this reread, Jack's descent just terrified me.  I found myself more drawn to Wendy's character and that, coupled with the idea that you could be living with someone who's going completely crazy and you don't know it, kept making me stop listening to the book for several days at a time. It is just so scary to think I could think everything was fine while B is sitting there thinking about taking a roque mallet to my head...not that he would.  This book is just so intense and frightening; i'm really really glad i reread it. a 6.

Want an amazing fabulous review?  Go check out Grady Hendrix's review at Tor.com (they are doing a reread of a good bit of King's early work) for a spoilery, but better written, review.

21 November 2012

A book I was weepy through

I, rather quickly, read Mortality by Christopher Hitchens.  It is a short collection of his last columns for Vanity Fair, the ones he wrote as he was dying of cancer.  The circumstance of the columns would be enough to get me teary even if he had been writing music reviews but the subject certainly kept me teary.  He writes of dying, how from the cancer he begins loosing his humanity, his voice.  He has an amazing tone in all his writing that I don't know that i've read anywhere else.

I have to read more Hitchens, which I think I said the last time I read something he wrote.  a 6. 

20 November 2012

Marvel 1602

The graphic novel kick continues!  Somehow I'd missed Marvel:1602 by Neil Gaiman and Andy Kubert.  Another library score!  This book is all over the place character-wise, we've got all sorts of people, both good or bad guys, big characters and small.  Of course, some of the characters I might have considered small a few months ago have a bigger profile now, like Black Widow.  It is an interesting take on the world; how would our heroes operate when communication can take days and travel can take weeks?  Mutants are called witchbreed and, of course, are supposed to be demons.  Nick Fury is the Queen's spymaster, Daredevil and Black Widow are agents.  There are some bad guys, Magneto for instance, but there's a bigger evil lurking around as well.  The art is great and i really like the etching covers.  a 5.

13 November 2012

The Ultimates 2

So I jumped right in and was able to get The Ultimates 2 by Mark Millar and Bryan Hitch.  Wow.  I actually think I liked this one more than the first though again the characters were very different from the movieverse.  There's some inter-team fighting, super solidiers from other countries, Hawkeye being the most amazing badass.  There's more Hulk and Thor and explosions! And Tony being a genius!  and Nick Fury being a BAMF!  and the Xmen have a cameo!  so, a 6 from me and the beginning of the series is highly recommended. 

11 November 2012

The Ultimates

I really loved the recent Avengers movie.  I never read The Avengers as I was an X-men fan as a teen and wanted to get some idea of the characters comic book versions.  I saw a post on Tor.com (the one which also led me to the Astonishing X-men series i read in the summer) and decided to pick up The Ultimates by Mark Millar and Bryan Hitch.  The only reason it took so long to get to it is because the library didn't have book 1 and i kept expecting them to get it.  I finally decided I had to read it RIGHT NOW so went to Books a Million after the local used store didn't have it.  That was a shopping trip straight out of my teenage fantasies as i ended up getting the big compilation rather than just the part the library didn't have.  I dropped $60 on comics, chocolate and Doctor Who swag, which was pretty much what i thought all shopping trips would be like when i was a kid!

This set is a story of the Avengers getting together and battling the Chitauri.  But completely differently from the movie!  Tony's still an playboy, billionaire, genius but he's not dating Pepper, Hawkeye doesn't get possessed and he has a wife and kids, Thor is a environmental hippie that may or may not be delusional.  Bruce Banner is WAY more of a weenie

I liked this set, though things are different from the movie. Particularly the Bruce Banner/Hulk character. I read somewhere that reading this after the movie is like seeing Avengers 2 and it really is! I can recommend it but you need to remember this came out prior to the first Iron Man movie.  a 5. 

23 October 2012

The Graveyard Book

I love The Graveyard Book by Neil Gaiman!  I read and reviewed it for the blog back in 2008 and this time decided to listen to the audiobook, mainly because I knew that i would get through it if i listened to it (i'm having troubles actually reading physical books at home, school=arg) and also because Gaiman narrated it.  

I absolutely love this book.  It just hits all of my buttons; it is growing up and love and loss, about learning and becoming your own hero, about family and friendship and is very bittersweet.  It is a book that i want to recommend to everyone and can't wait until the nieces are just a little older to send it to them!  a 7.

21 October 2012

Frankenstein!

I am a member of an online sci-fi book club.  Each month we read an old book (pre-1982 right now) and a new book (post-1982, though we seem to choose things from the last 15 years).  While i don't read everything, or even half i would bet, I do follow the discussions and get a lot of enjoyment out of the varied opinions and recommendations.  This month we had Frankenstein and The Windup Girl and though I really wanted to read both I only got to do a reread of Frankenstein.

I listened to this one on audiobook but i have read it a few times previously.  I remembered the general story but had forgotten the little details. I'd forgotten how whiny Victor is!  He just seems like a big teenager, never taking responsibility for his actions and never thinking anything through.  I just wanted to grab him and shake him a few times.  I enjoyed the reread but Frankenstein will never be the favorite of mine that Dracula is. 
The images and lyricism of the writing is lovely and there are so many modern ideas packed into Frankenstein that I think everyone should take the time to read it.  

Counts for RIP and a 5 from me!

16 October 2012

More Baths, Less Talking

When I realized Nick Hornby had a new collection of columns from The Believer, titled More Baths, Less Talking, I immediately put it on hold at the library.  I actually got it very quickly.  I read it far too fast.  I love Hornby's essays and not just because he's also an Arsenal fan! They are funny, intelligent and informative. He made me want to read a 700 page book about a country during a time I am not interested in! Checking back, i read the last collection back in 2009 and have since learned much, much more about British culture.  B introduced me to Doctor Who, Top Gear, and Premier League football, so I actually "get" many more of Hornby's references now.  I kinda want to go back and reread the previous collections; the whole series is highly recommended!

13 October 2012

The Night Circus

“Someone needs to tell those tales. When the battles are fought and won and lost, when the pirates find their treasures and the dragons eat their foes for breakfast with a nice cup of Lapsang souchong, someone needs to tell their bits of overlapping narrative. There's magic in that. It's in the listener, and for each and every ear it will be different, and it will affect them in ways they can never predict. From the mundane to the profound. You may tell a tale that takes up residence in someone's soul, becomes their blood and self and purpose. That tale will move them and drive them and who knows what they might do because of it, because of your words. That is your role, your gift. Your sister may be able to see the future, but you yourself can shape it, boy. Do not forget that... there are many kinds of magic, after all.” The Night Circus by Erin Morgenstern

So this piece is toward the end of the book and I won't say who say it to whom.  I finished The Night Circus by Erin Morgenstern on audio book yesterday.  This book started great, then I faded out in the middle bit, then I loved the ending.  I've read people compare it to Harry Potter but, other than they both deal with magic existing side-by-side with our reality, I don't really see it.  While there are some unpleasant people there really aren't any bad guys to root against.  I think the reason I didn't particularly like the middle was that I just wasn't liking the vagueness of the contest and the shifts in perspective didn't really work for me.  The back and forth between the main story and the Bailey story was ok but the addition of the clockmaker's story (which I loved on its own) and then the first person sections (which i didn't care for but did make sense at the end) just kept tearing me out of the main story.  The writing is lovely and the characters interesting.  There's a lot of sadness without being depressing or melancholy.  It is a very moody and dreamy book and very very fall.  or maybe that's just me because i love Something Wicked This Way Comes and that's another circus/carnival book that takes place in the fall.

Anybody think i can count this for RIP?  a 5 for me. 

11 October 2012

The Sweetness at the Bottom of the Pie

On Monday I finished a reread of Alan Bradley's The Sweetness at the Bottom of the Pie.  I then spent at least 45 minutes trying to find out when I read it before.  I actually had to look up the publishing date (January 2009) and work my way forward month by month through the blog;  thank goodness for CTRL-F!  Turns out I read it in May of 2010 and that bloggers little "search box" sucks ass.  as in, searching for the title or Flavia or Bradley did not pull up the post, I suppose because none of those words were in the title?  strange.  

I loved this book as much this time as i did the first.  And with the reread I am seeing the threads a little better.  I really liked revisiting this one for RIP!

 

07 October 2012

Update!

While I did a sorta update for the End of the World Challenge post I never did update with my normal numbers post.  so here we go!

Total books read in 2012:  50
Library books: 39
Non-fiction: 9
Audio: 16
Graphic Novels: 11

For Challenges:

Non-fiction Non-memoir challenge: 4
Science Book Challenge: 1
Chunkster: 2 (i've read plenty of longer books but they've been on audio
RIP: 0 (got a couple in progress)
Total pages for the End of the World Challenge:  11722 (doesn't count rereads or graphic novels)

I am low for me!  Last year I read 98, year before 136.  I have had a lot of stuff going on this year though!

06 October 2012

Wow

Ok, i've really gotten bad about updating.  I'm reading, a bit, but not much really.  listening to audiobooks some.  We closed on our house on 8/29/12 and have been moving and trying to figure out this new space.  The semester started also and my classes this semester are much more demanding.  More reading, more assignments than my previous semesters.  Throw in being sick in bed for 2 days followed by sick and laying on couch for the 2 following and that puts me way out of my normal routine.  Oh, and work has moved me around and requiring about 3 hours of overtime every week now.  It doesn't sound like that much but it really does make a difference in what i do.

So, with all that, i'm going to tear through some mini-reviews!  I want to catch up to where i am now in reading and then hopefully i can keep up with what i'm reading as i finish it.  I am working on a reread of The Sweetness at the Bottom of the Pie and Frankenstein as well as listening to The Night Circus in the car. The next audiobook is The Graveyard Book (another reread) while the next physical book will either be a library book or, if I can find it in our boxes, perhaps The Shining.  I don't know why but I am really in the mood to go back to my favorites.

Way Station by Clifford D. Simak: Sci-fi, classic.  guy becomes immortal who has to man the rest stop of an alien teleportation network.  I liked it as i was reading it but whenever i set it down i never felt compelled to pick it back up.  a 5.

Reamde by Neal Stephenson: really really good action.  It reminded me a bit of Snow Crash (the virtual world affecting the real one) but had its own thing going on.  recommended! 6

The Read Aloud Handbook by Jim Trelease:  read for library school.  I am taking a "Programming for Children and Young Adults" (by programs they don't mean apps, they mean planned activities attended by the client groups) and Reading is Fundamental! 6

Crime and Punishment by Fyodor Dostoyevsky: Ok, i am giving the russians a break for a while. This book should be subtitled "Men are judgemental, egotistical assholes".  While I was listening to it, and getting sicker and sicker of doing so, i hated it.  the last half picked up a bit and at least moved along but i still disliked all the characters.  However, being about 6 weeks since i finished it, i'm beginning to be glad i read it.  If a good book is one that makes you think, and keep thinking about it after it's over, then apparently Crime and Punishment is a great book.  so i am going to give it a 5 rather than a 3. 

Ready Player One by Ernest Cline:  I finished Ready Player One by Ernest Cline about a week before the wedding but in all the chaos i never got around to reviewing it.  I remembered because Amazon recommended it to me just now.  The book is amazing!  I loved it and i loved Wil Wheaton reading it.  The Oasis is definitely one way I can see gaming/the Internet going.  a 7.

so now I am going to do a bit of homework reading, then homework writing then, if i have time, some fun reading!  Whew!

30 August 2012

R.I.P.ping Again!

Even though the high today was like 90 here in Nashville, it is time for that fall favorite of mine to begin. Carl at Stainless Steel Droppings has posted the perils for the 7th! time now.  I'll be reading 4 books and one will be The Graveyard Book by Neil Gaiman which is the group read for October. I read it a few months after it came out and loved it and would definitely like to reread it.

Here are a few new read potentials:
  • Midnight Riot by Ben Aaronovitch (TBR)
  • The Mystery of Udolpho by Ann Radcliffe (just picked up from library)
  • Interred with Their Bones by Jennifer Lee Carroll (TBR)
  • Sandman: Endless Nights by Neil Gaiman (TBR) 
  • Feed by Mira Grant (TBR)
  • American Vampire Vol 4 comes out October 2
and a few possible rereads:
  • I'd love to get through some Sherlock Holmes
  • The Sweetness at the Bottom of the Pie 
  • It's been a long time since i read Interview with the Vampire or The Vampire Lestat
Plus, we'll be packing and moving all our books so I may discover a few of B's that fall in this category (that's a whole different post, forthcoming).  I am sure we'll watch a few scary movies too. 

 What spooky story will you read this fall?

27 August 2012

It's that time again!

Time for my pretty much biannual Shakespeare play review!

This year, Shakespeare in the Park put on Much Ado About Nothing.  This one is probably my favorite of the comedies.  I think i always identified a bit with Beatrice and Dogberry is just amazingly fun to a word geek like me.  For this production, they updated the setting to 1945, swapped Hero's parent's gender, and added songs! It is great fun. Beatrice and Benedict are fantastic, Hero can really sing, the bad guy gets a "i'm so evil" song that was great.  Highly recommended!  Go see it if you'll be in Nashville any of the next 3 weekends!


23 August 2012

BTT for 8/3/12

Had to jump in for this question!

Do you like to talk about what you read? Do you have somebody to talk WITH?


So I get to brag on B some more!!  Before I met him I didn't really talk to anyone in real life about books except when I went home to Louisiana or was around my family.  I had the blog of course but it just isn't the same.  Now, we talk about what we're reading, what we want to read, what we read a long time ago, all the time!  I went over some old emails recently and books read and unread were a huge topic of our early conversations.  And what he reads changes what i read and vice versa.

Example:  B was shocked I hadn't read Snow Crash by Neal Stephenson, so I did.  Since i liked it, later I listened to Anathem and recommended it to B. B listened to it, then read Reamde, which he recommended back to me and i'm listening to it now! It's the Circle of Reading Life!!    




18 August 2012

Locke and Key #5

In Locke and Key Volume 5: Clockworks, we get a ton of backstory.  FINALLY!  We learn where the keys came from, what's in the cave, what Dodge really wants, what the kids' dad did as a teen.  This book was what i wanted much earlier!  I get that this couldn't have been the first story but i feel like i would have liked 3 and 4 way more if i'd had some of this information earlier. 

Just read online that there will be one more volume then the series will be complete.  Excellent!  I've found I'm growing to like complete stories more and more, whether they be books, movies or TV shows.  Maybe because real life is so incomplete?  So many things happen where you never find out the end of the story.

So hey, sometime next year there should be a complete series.  YAY! 

13 August 2012

The Violinist's Thumb

I finished The Violinist's Thumb: And Other Tales of Love, War and Genius, as Written by Our Genetic Code by Sam Kean.  Kean also wrote The Disappearing Spoon about the elements of the periodic table.   This book is about DNA and genetics.  About how your genes can be your gift and your curse, what we've learned and how we learned about genes and DNA, and how much is unknown.  Did you know that humans appear to have less than 25000 genes?  and tomatoes have over 31000?  isn't that weird?  

Kean talks about fruit flies, Watson and Crick, cloning, Darwin, birth defects, Mendel, the Human Genome Project, Paganini,  Thomas Jefferson's descendents, and much more. a lot of topics to cover in 350 pages plus endnotes (read them, they're funny).  Kean's a good writer and turns these various topics into a compelling story, a great narrative of science

Like science history?  pick this one up, if you have some basic knowledge.  I don't know if it is quite basic enough for someone who knew nothing about genetics and biology to really understand it.  I recommend it, especially if you read and enjoyed The Disappearing Spoon or anything by Mary Roach.  a 6.


tctaaagaggctaactaattacgcgaacttaggttacacttagtacaagtcattagtctgtgggaccacaggtta

05 August 2012

Hell House

The entire time i was reading Hell House by Richard Matheson i kept thinking "have i read this before?"  Then I realized I hadn't but i had read Shirley Jackson's The Haunting of Hill House. Both books have the same setup: a couple of psychics and a scientist go investigate a haunted house.  But there is far more sex and gore in the Matheson version.  We also get in the heads of the various characters and see their perspectives on the haunting. 

I didn't really connect with any of the characters, which i think you kind of need to do with horror books.  You have to care about them and want them to live or, conversely, dislike them and hope they are next.  I think part was just the time it was written and set.  The women were just so cliched.  The scientist was also pretty stock.  The ex-psychic was the most interesting, but perhaps that's because he shares his first name with my husband (heehee, i can't get used to saying that!).  Anyway, if you want to see a different version of the Jackson story to compare and contrast, or you love Matheson and/or haunted house stories, I'd say give this a shot.  If not, you probably won't mind missing it.  a 4 from me.

04 August 2012

Time Untamed?

I finished up a book of short stories called Time Untamed.  It was published in 1967 by Belmont Books.  Collection of big names: Asimov, Bradbury, Clifford Simak, Fritz Leiber, Wyndham, Theodore Sturgeon, Robert Bloch, L. Sprague de Camp.  It has a weird mix of stories though.  The Bloch, Sturgeon and Leiber stories are pretty straightforward horror stories.  L. Sprague De Camp's is fantasy.  While the rest are sci-fi, it was just a strange compilation.  Not even very sure why the collection has the title Time Untamed, only one story, Bradbury's "Tomorrow and Tomorrow", has anything to do with time travel.  The Asimov story is "Sally" and after reading it I wondered if the people at Pixar are fans of Asimov.  Sally is the name of a car in the short story and in the movie Cars and the description in the story is similar to how she looks in the movie.  The cars in the story don't speak but they do have positronic brains.  I really enjoyed the collection but am just puzzled on how/why these stories were collected together.  Recommended!

03 August 2012

Fables 17

I'm loosing some interest in Fables.  Volume 17, Inherit the Wind, sorts out which of Bigby and Snow White's children will take over for the North Wind.  We get a little more of Mrs. Spratt and a bit of Rose Red and her scouting party returning to The Farm.  There's also a bit of Bufkin in Oz but i feel like i didn't quite catch what was going on there.

I honestly feel like the series is waiting for something to happen.  Like they had decided Mr. Dark was going to be the next big storyline but then decided to get rid of him after 2 books instead, though i do realize in the real comics it played out over many months.  But the story felt both rushed and drawn out because Mr. Dark was such a "comic book" villian, where Gepetto was (and is) way more complex and interesting.  Where's he anyway?

Overall, i'll keep reading but I hope the series takes a more exciting turn soon.

02 August 2012

1000 posts!

This entry makes the 1000th I've written on this blog. My life has certainly changed since December of 2005 when I started this blog or from February 2007 when my random posts morphed into a book blog.  I don't do a ton of reflecting or looking back so let's do a bit now. 

I've met an amazing man and we got married.  I've changed jobs and gone back to school for my master's degree.  We just had our offer accepted on a house!  I've read an amazing number of really great books and some stinky ones. I've seen amazing movies and terrible ones.  I went from having one niece to having three nieces and two nephews and gained another whole family who are just great.  I've gained the chillest dog ever.  I've gone to New York and Asheville and Vermont.  I've gone skiing and to football games and to plays.  I've met a great group of people on Meetup.  I've made a bunch of blogging friend.  I've cried a bunch and felt the worst I ever had.  I've been amazingly gloriously happy!  I've found new fandoms.  I've got goals and plans and ideas!  I've learned about myself and what i want and what i need.  


life's amazing isn't it? 

30 July 2012

The Dead Witness

So, over the last 6 weeks the only book reading I've done (as opposed to audiobook listening) has been from a collection of Victorian mysteries called The Dead Witness, edited by Michael Sims.  It's about 550 pages and includes short stories, excerpts from longer works, and even a bit from the news of the time regarding Jack the Ripper.

The collection starts with "The Secret Cell" by William Burton, which has apparently not been published since its original publication in 1837.  It isn't the strongest story but is a good start.  Sims proceeds chronologically and brings in some rare stories from outside the US and Britain and several by women authors.  Rue Morgue is the second story but Holmes doesn't show until page 267, showing how many people were writing between the two authors. The quality does go back and forth but it's hard to compare detective stories written by Mark Twain or Arthur Conan Doyle to someone unknown to you

I'll be looking up C.L. Pirkis, who wrote about a woman detective Loveday Brooke, and George Sims, whose detective was an ex-actress Dorcas Dene.  Robert Barr wrote about a proto-Poirot named Eugene Valmont and Hesketh Prichard about a backwoods detective called November Joe, who seems to know as much about life in the forest as Holmes knew about life in London.  Finally, Anna Katherine Green wrote about a society debutante, Violet Strange, whose position allowed her to access to places the police and other detectives could never go.  

Unfortunately, finding more by some of the authors is going to be a bit difficult.  Quickly glancing around amazon found collections by some authors but my library doesn't seem to have them.  However, much should now be in the public domain and i did find a couple of anthologies for free via Kindle.  any book that sends me off to read 4 others gets a recommendation for sure!  a 6 from me and anyone who enjoys old mystery stories should check it out. 

28 July 2012

Wedding post!

I've been silent the last few weeks because I was just too busy leading up to the wedding!  Not really reading, though i was slowly working my way through a book of Victorian mystery short stories, because i could only concentrate for 20 minutes or so.  I was so scatterbrained and will certainly not miss the ADHD feeling i had.  Now, onto the wedding.
B and I.

We got married at a friend's house here in Nashville.  We rented tent, chairs, tables and other various things.  We planned for around 40 guests and I think that's around what we had.  They have a huge backyard and we had plenty of room, even to set up a bar tent.


part of the ceremony area.  stole the sign idea off Pinterest.  We didn't need the umbrellas!

The weather pretty much cooperated; it was hot directly in the sun but under the tent or in the shade was fine. The wedding was supposed to start at 5 but i think we ran about 15 minutes late.  We had music and dancing, plenty to drink and eat, and books on the tables! Several times i spotted people flipping through our decorations!

Probably the first time in four years my brothers and i were all together with our parents.

A huge highlight, besides the actually getting married bit, was seeing so many members of our families together.  Our flower girls were our nieces, one from each side, and they really hit it off!  Our mom's got on great and everyone was so caring and helpful and amazing. 


The Wedding Party, minus the kids.

 My Best Woman D and her partner.  They were so gracious to let us use their house and yard!

More details: we walked out to a couple tracks from The Lord of the Rings soundtrack, Concerning Hobbits and the instrumental version of Into the West.  It was really a Do-It-Ourselves production as most of the decorations we made (those big flowers behind us above, the fans, the bookmarks), were family made (those cool table runners were made by B's mom) or were things we already had (like those books on the tables).  A friend pitched in to tend bar, a different one did the pro photos, a third married us, a fourth made amazing jambalaya for the reception while i whipped up red beans and rice.  B set up the sound system and we made a "mellow" playlist to have running while everyone ate and then a "dance" one for, well, dancing!  

 B and I, first dance was to "Librarian" by My Morning Jacket.  

B's sister and her son.  Had a train gone by during the ceremony, he had a "Pause for train" sign ready to go!  

My brother and his youngest daughter.  She turned 1 the next day!

The kids used the music as an opportunity for a game of musical chairs.

oh, ceremony bit!  Civil, not religious.  We used Union by Robert Fulghum and part of the ruling on the case that legalized same-sex marriage in Massachusetts. Did our own vows and they were great. I couldn't decide what shoes to wear so we all decided to be barefoot, even the officiant!
The ringbearer, my nephew, passes the ring box to the Best Man.

Some part of the ceremony.  


Everything just came together so well. I definitely stressed too much prior to the day.  Not about the "getting married" bit but about organizing for and feeding 45ish people.  That's not what i'm used to doing and our moms, the Best Woman and her partner deserve super thank yous!

Our parents and us.

Ok, I'm done!  Gotta go write more thank you notes.  

Photos by Richard Call Photography, B's mom and my sister-in-law J, mom of the ringbearer, a flower girl and the little one!

26 June 2012

Hitchhiker's 3 and 4

 I've been listening to these on audio and really enjoying them.  Martin Freeman (Arthur Dent in the Hitchhiker's movie) does a great job reading.  I did like Life, the Universe, and Everything way more than So Long, and Thanks for All the FishLife had a bigger, grander story while So Long is a smaller tale and never gives us an explanation for the new Earth. I did like the Rain God, which i remembered but thought i had read in a Neil Gaiman book.  I give part 3 a 6 an part 4 a 4.  

16 June 2012

mid year summary

page count for End of the World Challenge: 7642.  that doesn't count my rereads, graphic novels, or a couple that i started in 2011.

so yeah, i bombed on the blogging challenge this month.  I went 2 days before i realized i had forgotten.  In my defense, this week we: met with a realtor and a bank dude to start looking at houses, put our invitations together (which involved much cutting, pasting, inserting, writing, stamping (with stamps and with wax) and collating) and my mom came in town so i had to clean a little. 

stuff is starting to come together for the wedding.  Thinking about having a friend of a friend cater with Cajun food then adding in my own red beans and rice, vegetarian version. throw in salad and bread and fruit and that's a meal right?


*sigh*


10 June 2012

Bradbury

I've read various short stories by Bradbury over the years and he wrote two of my favorites: Something Wicked This Way Comes and Fahrenheit 451.  I picked up The Martian Chronicles and read it over the last couple days as it was the only one I had in the house.  I also read "The Sound of Thunder", one of Bradbury's short stories.  

 I liked The Martian Chronicles but it seemed a bit disjointed.  Some of the chapters were previous short stories and those chapters were actually the very best.  "And The Moon Be Still As Bright" and "The Night Meeting"  were both very good; "Usher II" was a wonderful creepy story, both for the censorship it details and the house on Mars.  On a whole the book has that very dreamy feeling that all old sci-fi seems to have.  a 5 from me.


Think I will try to pick up Dandelion Wine or The Halloween Tree

09 June 2012

Torn and Unstoppable

I read Volumes 3 and 4 of the Astonishing X-Men, Torn and Unstoppable, and I am really glad I did.  There is action, fighting, torture, revenge, aliens, monsters, chases, escapes, true love, miracles..heh, but true. 

 Anyway, in Torn much psychic craziness occurs and we find out what's up with the Hellfire Club.  In Unstoppable, crew gets transported to an alien world which has a prophecy that an X-Man will destroy it.  There are deaths and resurrections, people using their powers in interesting ways, someone without their power through the majority of the books, sex, and paper chains.  These books are not where I would start as a reader.  They reference a lot of previous events, some of which i read and a few i didn't but i was able to keep up.  If you read X-men through the 80's and 90's but haven't recently, you may enjoy these.  I did!

08 June 2012

Wimsey

I can't believe i JUST found Dorothy Sayers and Lord Peter Wimsey. I loved Agatha Christie in middle and high school and it is so surprising I never heard of this character and series.  Of course, there was no internet then and i wasn't the sort of kid to go ask a librarian for a recommendation.  

Anyway, i finished The Unpleasantness at the Bellona Club today.  Wimsey is brought in on a completely unsuspicious death to determine the exact time of death.  If the old General died before his equally old sister, the money goes to the sister's companion, if after, to the General's two sons.  Of course, events get curious and Wimsey has to use a good bit of his cleverness to figure it all out.  I certainly didn't guess who the killer was.

I guess I like Wimsey because he's all competence and properness covered by quips and a bit of playing the buffoon.  He's clever and but haunted.  The setting is just so British it's a bit weird; it is like a fantasy novel as it is just so different from what life is today.  Quite well written.  a high 5 from me.  

07 June 2012

BTT for 6/7

Here's the question:


and here's my answer!

  • The Weasley Twins
  • Armand from the Vampire Chronicles
  • Naomi from The Eyes of the Dragon
  • Ford Prefect
  • The Marquis de Carabas from Neverwhere 
  • Dogger from the Flavia de Luce books
I'm having issues!  I keep thinking of main characters!


06 June 2012

Update

wasn't feeling too well today.  basically slept until noon, then coffee and more sinus meds and a few emails, then rewatched Aliens with B, and an episode of Mad Men (i've not seen any of it and B wanted me to watch the first episode) then some dinner and Mission Impossible: Ghost Protocol.  It was a fun movie;  I'm a big Simon Pegg fan.  I'll be off to bed soon!  Hope everyone is well!

05 June 2012

Just Ugh

I really had about decided to book the place at Vandy even though it's twice the budget.  I just want to get something settled!  but now i'm looking at it again and that price doesn't even include dishes or tablecloths or napkins or anything! 

So here's what we've got sorted:
  • My dress
  • My Best Woman's dress
  • the flower girl dresses!  
  • Invitation designed, just need to get the details finished so we can mail them
  • boutonnieres ordered
  • What B's wearing--decided, not purchased
  • Cupcakes pricing.
  • Photographer
Yes, i know that I'm doing the easy stuff.   the cheap stuff.  But dammit, this shit is hard!  Every place i've found that i've liked isn't reasonable, is booked, or doesn't allow alcohol.  So: future guests, i'm thinking you're going to have to prepare to be warm! 

04 June 2012

Astonishing Vol 2

I so love the library!  Picked up Volume 2 and tore through it late last night.  Ever wonder what would happen if the Danger Room's computer had a body?  and was pissed?  If so, pick up this volume. Action packed with a quick appearance by the Fantastic Four and the Avengers get name dropped.  Still lots of Cyclops/Emma but there is certainly some foreshadowing....

03 June 2012

Am I going to start reading X-Men again?

So i read the first collection of Astonishing X-men by Josh Whedon and John Cassaday. In this particular series, Jean Grey is dead and Xavier is not around.  Cyclops and Emma Frost are running the school and have brought in Beast, Wolverine and Shadowcat.  A rather strange grouping of x-Men if you ask me.  A colleague of Beast's announces to the world she has a cure for the "genetic disease" of mutation.  However, rather than developing it herself, she seems to have an alien backer who gave her this cure in an attempt to stop some sort of future doomsday on an his world.  He's a bad guy though.

So, these aren't my favorites but i thought the story was solid.  When i read the comics, Kitty Pride wasn't in the US, she was over in Excalibur.  Emma Frost was a bad guy until right before i stopped following X-Men and i never really liked Cyclops.  Wolverine is exactly the same as i remember, as is Beast.  I'll be continuing this series.  a 5.

I haven't read X-men in probably 17 years.  I really loved the comics in high school but once i started college my purchases tapered off and by my sophomore year i wasn't reading them anymore.  School work, real work, boyfriends, etc just sapped my dedication.  I still liked being "the girl who knew about comics" and certainly benefited from it a few times but I probably didn't read any for 8 years.  Then i slowly started getting back in via graphic novels.  I started with Sandman, then read some Alan Moore.  I read Y: The Last Man and liked The Walking Dead before the series came on tv. What made me pick up X-men again?  tor.com had a column of "stuff to read if you loved the Avengers movie" and said the Whedon/Cassaday run on X-men was quite good. 

there's also been a discussion rolling around my sci-fi reading groups: are superhero comics sci-fi or fantasy? I have to think most of them are sci-fi.  The characters have genetic mutations (X-men), the result of successful experiments or unforseen accidents (Hulk, Spiderman, Fantastic Four, Captain America), are aliens (Superman, Thor) or are geniuses with amazing technology (Batman, Iron Man). while most of the stories are supposed to take place "today" there is frequently futuristic technology used.  Comics often have the "wow" factor and optimistic tone of sci-fi as well.  While it may be someone's personal fantasy to be Superman or Spiderman, I don't think that is enough to define something as "fantasy".  just my opinion!

02 June 2012

I am going to try to do NaBloPoMo this month.  Yes, it is a bit crazy for me to say I want to blog every day when i've barely been writing in here at all.  I do miss it though and miss the reading that went along with it.  So i am going to take a stab at making 30 (well, 28 after this one) posts in a row this month.  The theme is "Jump"; not sure how many posts i'll make along the topic.  

So, to the wedding bitching!  :)

Date is July 21.  set. period.  My dad gave me 3 weekends he was available this summer and that was the only one that didn't conflict with niece/nephew in NYC's school schedule or the best man's math conference.  My future sis-in-law has gotten a house to stay in, as has my parents and brother's family.  People have plane tickets!

I still don't know where it is going to be!  

We are having a small wedding. My guest list right now is 32 people, plus another dozen that may/may not come.  You would think it wouldn't be hard to find a place for 34 people (gotta count me and B!) to have a bit of dancing and food and drinks in some air conditioning without being crazy expensive.  It is though.  The problem is even the smallest places i've found hold a minimum of about 100 people.  So they are priced for 100 people.  Now, if i was calling around 2 weeks before the date i might find someone to cut me a discount then but that is not what i want to do at all.  Then i also keep running into the issue of "no alcohol".  Seriously?  or your decent cost for the rental only covers 4 hours.  yeah, um, not enough time to decorate, have a reception, and clean up.  My Best Woman has been awesome and made us some amazing invitations but i need to give her a place to add in so we can send the darn things!


So, i've got a couple calls to make Monday, if those don't pan out then seems like we've got a coin flip:  move the time to like 5, rent a tent and everything and have it in the Best Woman's backyard or break out the credit card and rent the Vandy room.  


ugh!

01 June 2012

I finished Bleak House!

Ugh.  I finally finished Bleak House by Charles Dickens.  I am going to lay off Dickens for a while.  I listened to this one on audio book and it just took forever.  It isn't necessarily that bad, just desperately in need of a good editor.  I had a tendency to forget who was who as there were so many characters, some of which would be gone for several chapters (or a couple cd's in my case) at a time.  And, other than the narrator Esther, i didn't really care much about them.  In truth, i knew i was really over this book when the adorable urchin died and my one thought was "yay, fewer characters/subplots!".  ah well.  

I am going to cleanse my mental palate with some comics now.

13 May 2012

Clouds of Witness

Soo, I am just throwing up a quickie for this book.  I enjoyed Clouds of Witness by Dorothy L. Sayers. it is the second book in the Wimsey series.  In this one, Wimsey's sister's fiance is found dead by Wimsey's brother.  Brother is then charged with the murder and the book consists of Wimsey attempting to determine what happened.  It's a neat, clever book and worth it if you enjoy old English mysteries. 

What have I been up to?  Wish I could still say school, but that finished up on May 1.  Got at least 1 A, not sure about 2nd class yet. Wish I could say the wedding is planned but it isn't.  Ive been watching a good bit of TV, messing around on the web and working a bit of overtime.  There's also a book i read but can't remember so that one should be in one of my gaps.  I've started a couple that i didn't finish.  Oh, and B's sister came in town and he and she ran the half marathon, so that was a weekend gone there.  I haven't been productive at all!  as part of having summer off, i do plan on making sure i keep up the blog!  I kinda miss it.  i've been reading a good number of blogs but haven't really been participating much.  Ah well.  


oh, and watch Sherlock!

01 May 2012

American Vampire Vol 3

Best one so far.  Better than part 2 at any rate.  we've moved up to WW2.  we learn about some pretty disturbing vampires in Japan and what the Reich's been up to on the vampire front.  Pearl kicks some ass and so does Cash (the lawman from Vegas from the last book).  Great writing, great art.  Read it!

30 April 2012

Nerd Do Well

Fabulous book.  Simon Pegg is as funny on the page as he is on the screen.  very recommended if you have any geekiness in you . 

18 April 2012

The Unwritten 5: On to Genesis

Finished The Unwritten Volume 5: On to Genesis by Mike Carey, Peter Gross and Vince Locke.  I really liked this one; i've loved the whole series actually. 

And i've forgotten a book.  i've got to get back to properly updating this blog. 

13 April 2012

Hard Times is OVER!

The audio book anyway.  Not sure about the general hard times people are having.  I listened to Hard Times by Charles Dickens and I have to say it was not much fun.  It is hard to judge older books at times; things that seem like cliches now may have been fresh then, plot twists may not have been telegraphed to a reader then the same way it seems now.  Essentially the book is about a few people in Coketown.  Mr. Gradgrind is a man obsessed with facts and raises his children, Louisa and Samuel, to eschew fantasy and feelings and imagination.  Bounderby is a business owner in the town and, very creepy, lusts after Louisa, who at the start of the story is about 14. eewww.  There are a couple of laborers, Samuel Blackpool and Rachel, who both have difficult lives.  

The Gradgrind children grow up and Louisa does marry Bounderby.  eeewww again.  Tom works for Bounderby at his bank and uses his sister to make his life easier.  Bad things happen, Louisa almost has an affair, then more bad things happen. 

I just felt like this book was A Lesson To Be Learned, not a real book.  There were lovely phrases but the characters (except perhaps Louisa) are all stereotypes.  i just couldn't enjoy it.  a 3 for me. 

12 April 2012

Bringing Up Bebe

I don't have kids at this point.  So, I'm not sure how Bringing up Bebe by Pamela Druckerman came up on my reading radar.  For whatever reason, i read a review and wanted to read the book!  Reading this book made me actually feel like I might could handle the motherhood thing.  Granted, it would be easier in France with paid leave and daycare and such, but I still feel like I could do it.  It also made me decide that, if i ever do have a kid, not to go online to a single pregnancy site.  I know myself and i will freak myself out. 

So there's also a theme that's mentioned in the book that i've also read around the web.  That's of men "helping" their wives with the kids and house.  Even my mom said something like "B's going to help you out right?"  For the longest i couldn't figure out why that irked me and then i read a post over on Offbeat Mama.  This post describes exactly how i feel.  "Helping" is what you do as a favor for someone.  If my best friend keeps my dog for the weekend while we go out of town, that's helping.  When B walks the dog, that's just taking care of the dog!  I think B and i are partners; one of us may do something more than the other, or be better at something than the other but we are sharing our lives.  I can't see why that won't continue on as we move along in our lives together.  

anyway, rant over.  I recommend this one, if just for the "living in France" aspect.  a 6. 

10 April 2012

Hitchhiker's Guide Part 2

I finished The Restaurant at the End of the Universe by Douglas Adams.  Martin Freeman (Arthur Dent in the Hitchhiker's movie, Watson in the BBC Sherlock, and some hobbit in some movie out later this year) read the version I listened to.  He is really great! His Marvin is wonderful and he pulls a New York accent out for Zaphod! 

It is strange listening to these books.  I read them, the first few volumes probably several times, when i was in middle and high school.  I remember parts of them, most of the basic plot points, but not much else.  Another thing is that i'm a bit more steeped in British culture now.  I've read more modern and older British novels.  I've read Nick Hornby's non-fiction.  I've watched the modern Doctor Who.  I've seen shows like Sherlock, Spaced, and Red Dwarf.  I love Sean of the Dead and Snatch and Children of Men and V for Vendetta.  Why do i mention all this?  Because i've read the books before i'm not trying to figure out what's going on and i can pay more attention to the words.  And because i'm a bit of an Anglophile now the jokes are more funny because they make so much more sense!  I can say i'm really enjoying the series more this time.  a 6!

07 April 2012

Spaaaaaaaace

I finished Space Chronicles: Facing the Ultimate Frontier by Neal deGrasse Tyson.  I can only half recommend it.  If you've listened to a few of his talks these last few years, you've heard much of the book. It is all very interesting but not new.  B and i had a bit of fun going over the charts and graphs at the end. 

06 April 2012

Rendezvous with Rama

I listened to Rendezvous with Rama by Arthur C. ClarkeWhile on vacation over Christmas, B had played it in the car as he was driving.  He mostly drove overnight while I slept so i caught bits and pieces of the story.  I heard the introduction by Robert J. Sawyer (Fast Forward, the WWW series) and probably the first third of the story.  Then I was asleep for a while, caught maybe an hour in the middle of the second half then heard the last 15 minutes.

I was interested enough by what i heard to give the whole thing a listen.  about 150 years from now, about 200 years from when Clarke wrote it, there is a network of satellites and telescopes searching for asteroids that may strike Earth or one of its many colonies.  There are colonies on the Moon, Mars, several moons, and even Mercury!  One of these satellites sees an anomaly which scientists name Rama as they are working through the Hindu pantheon of gods.  When scientists arrange a flyby by a probe, they discover that Rama is actually a spaceship of some kind.  It is a long cylinder made of metal which is hollow so the humans decide they must get inside.  The only ship that can get to Rama to investigate is the Endeavour, captained by an Australian named Norton.  They proceed to enter Rama, explore and see some amazing sights.

I really liked this book.  The majority of the characters are competent professionals; there aren't any "bad guys" on the Endeavour.  Everyone is smart, curious and highly trained even if they are applying that training to an entirely new situation.  I guess because everyone seemed, not realistic exactly because you hardly know about their internal lives, so dedicated you rooted for them and wanted to be there with them.  The story is very detailed so you really can see the action.  


Clarke seems really ahead of his time.  Several of the crew are female, including the ship's doctor.  Two of the male officers are a couple and share a wife who I think lives on the Moon.  Captain Norton has two wives with families, one on Earth and one on Mars (how he affords it I don't know).  Rather than the various nations running things, there is a planetary committee.  Overall it is very progressive. 

The only thing that keeps this from being a 7 from me is that the book leaves so many questions unanswered.  You should read it!