30 August 2012

R.I.P.ping Again!

Even though the high today was like 90 here in Nashville, it is time for that fall favorite of mine to begin. Carl at Stainless Steel Droppings has posted the perils for the 7th! time now.  I'll be reading 4 books and one will be The Graveyard Book by Neil Gaiman which is the group read for October. I read it a few months after it came out and loved it and would definitely like to reread it.

Here are a few new read potentials:
  • Midnight Riot by Ben Aaronovitch (TBR)
  • The Mystery of Udolpho by Ann Radcliffe (just picked up from library)
  • Interred with Their Bones by Jennifer Lee Carroll (TBR)
  • Sandman: Endless Nights by Neil Gaiman (TBR) 
  • Feed by Mira Grant (TBR)
  • American Vampire Vol 4 comes out October 2
and a few possible rereads:
  • I'd love to get through some Sherlock Holmes
  • The Sweetness at the Bottom of the Pie 
  • It's been a long time since i read Interview with the Vampire or The Vampire Lestat
Plus, we'll be packing and moving all our books so I may discover a few of B's that fall in this category (that's a whole different post, forthcoming).  I am sure we'll watch a few scary movies too. 

 What spooky story will you read this fall?

27 August 2012

It's that time again!

Time for my pretty much biannual Shakespeare play review!

This year, Shakespeare in the Park put on Much Ado About Nothing.  This one is probably my favorite of the comedies.  I think i always identified a bit with Beatrice and Dogberry is just amazingly fun to a word geek like me.  For this production, they updated the setting to 1945, swapped Hero's parent's gender, and added songs! It is great fun. Beatrice and Benedict are fantastic, Hero can really sing, the bad guy gets a "i'm so evil" song that was great.  Highly recommended!  Go see it if you'll be in Nashville any of the next 3 weekends!


23 August 2012

BTT for 8/3/12

Had to jump in for this question!

Do you like to talk about what you read? Do you have somebody to talk WITH?


So I get to brag on B some more!!  Before I met him I didn't really talk to anyone in real life about books except when I went home to Louisiana or was around my family.  I had the blog of course but it just isn't the same.  Now, we talk about what we're reading, what we want to read, what we read a long time ago, all the time!  I went over some old emails recently and books read and unread were a huge topic of our early conversations.  And what he reads changes what i read and vice versa.

Example:  B was shocked I hadn't read Snow Crash by Neal Stephenson, so I did.  Since i liked it, later I listened to Anathem and recommended it to B. B listened to it, then read Reamde, which he recommended back to me and i'm listening to it now! It's the Circle of Reading Life!!    




18 August 2012

Locke and Key #5

In Locke and Key Volume 5: Clockworks, we get a ton of backstory.  FINALLY!  We learn where the keys came from, what's in the cave, what Dodge really wants, what the kids' dad did as a teen.  This book was what i wanted much earlier!  I get that this couldn't have been the first story but i feel like i would have liked 3 and 4 way more if i'd had some of this information earlier. 

Just read online that there will be one more volume then the series will be complete.  Excellent!  I've found I'm growing to like complete stories more and more, whether they be books, movies or TV shows.  Maybe because real life is so incomplete?  So many things happen where you never find out the end of the story.

So hey, sometime next year there should be a complete series.  YAY! 

13 August 2012

The Violinist's Thumb

I finished The Violinist's Thumb: And Other Tales of Love, War and Genius, as Written by Our Genetic Code by Sam Kean.  Kean also wrote The Disappearing Spoon about the elements of the periodic table.   This book is about DNA and genetics.  About how your genes can be your gift and your curse, what we've learned and how we learned about genes and DNA, and how much is unknown.  Did you know that humans appear to have less than 25000 genes?  and tomatoes have over 31000?  isn't that weird?  

Kean talks about fruit flies, Watson and Crick, cloning, Darwin, birth defects, Mendel, the Human Genome Project, Paganini,  Thomas Jefferson's descendents, and much more. a lot of topics to cover in 350 pages plus endnotes (read them, they're funny).  Kean's a good writer and turns these various topics into a compelling story, a great narrative of science

Like science history?  pick this one up, if you have some basic knowledge.  I don't know if it is quite basic enough for someone who knew nothing about genetics and biology to really understand it.  I recommend it, especially if you read and enjoyed The Disappearing Spoon or anything by Mary Roach.  a 6.


tctaaagaggctaactaattacgcgaacttaggttacacttagtacaagtcattagtctgtgggaccacaggtta

05 August 2012

Hell House

The entire time i was reading Hell House by Richard Matheson i kept thinking "have i read this before?"  Then I realized I hadn't but i had read Shirley Jackson's The Haunting of Hill House. Both books have the same setup: a couple of psychics and a scientist go investigate a haunted house.  But there is far more sex and gore in the Matheson version.  We also get in the heads of the various characters and see their perspectives on the haunting. 

I didn't really connect with any of the characters, which i think you kind of need to do with horror books.  You have to care about them and want them to live or, conversely, dislike them and hope they are next.  I think part was just the time it was written and set.  The women were just so cliched.  The scientist was also pretty stock.  The ex-psychic was the most interesting, but perhaps that's because he shares his first name with my husband (heehee, i can't get used to saying that!).  Anyway, if you want to see a different version of the Jackson story to compare and contrast, or you love Matheson and/or haunted house stories, I'd say give this a shot.  If not, you probably won't mind missing it.  a 4 from me.

04 August 2012

Time Untamed?

I finished up a book of short stories called Time Untamed.  It was published in 1967 by Belmont Books.  Collection of big names: Asimov, Bradbury, Clifford Simak, Fritz Leiber, Wyndham, Theodore Sturgeon, Robert Bloch, L. Sprague de Camp.  It has a weird mix of stories though.  The Bloch, Sturgeon and Leiber stories are pretty straightforward horror stories.  L. Sprague De Camp's is fantasy.  While the rest are sci-fi, it was just a strange compilation.  Not even very sure why the collection has the title Time Untamed, only one story, Bradbury's "Tomorrow and Tomorrow", has anything to do with time travel.  The Asimov story is "Sally" and after reading it I wondered if the people at Pixar are fans of Asimov.  Sally is the name of a car in the short story and in the movie Cars and the description in the story is similar to how she looks in the movie.  The cars in the story don't speak but they do have positronic brains.  I really enjoyed the collection but am just puzzled on how/why these stories were collected together.  Recommended!

03 August 2012

Fables 17

I'm loosing some interest in Fables.  Volume 17, Inherit the Wind, sorts out which of Bigby and Snow White's children will take over for the North Wind.  We get a little more of Mrs. Spratt and a bit of Rose Red and her scouting party returning to The Farm.  There's also a bit of Bufkin in Oz but i feel like i didn't quite catch what was going on there.

I honestly feel like the series is waiting for something to happen.  Like they had decided Mr. Dark was going to be the next big storyline but then decided to get rid of him after 2 books instead, though i do realize in the real comics it played out over many months.  But the story felt both rushed and drawn out because Mr. Dark was such a "comic book" villian, where Gepetto was (and is) way more complex and interesting.  Where's he anyway?

Overall, i'll keep reading but I hope the series takes a more exciting turn soon.

02 August 2012

1000 posts!

This entry makes the 1000th I've written on this blog. My life has certainly changed since December of 2005 when I started this blog or from February 2007 when my random posts morphed into a book blog.  I don't do a ton of reflecting or looking back so let's do a bit now. 

I've met an amazing man and we got married.  I've changed jobs and gone back to school for my master's degree.  We just had our offer accepted on a house!  I've read an amazing number of really great books and some stinky ones. I've seen amazing movies and terrible ones.  I went from having one niece to having three nieces and two nephews and gained another whole family who are just great.  I've gained the chillest dog ever.  I've gone to New York and Asheville and Vermont.  I've gone skiing and to football games and to plays.  I've met a great group of people on Meetup.  I've made a bunch of blogging friend.  I've cried a bunch and felt the worst I ever had.  I've been amazingly gloriously happy!  I've found new fandoms.  I've got goals and plans and ideas!  I've learned about myself and what i want and what i need.  


life's amazing isn't it?