The Violinist's Thumb

-
I finished The Violinist's Thumb: And Other Tales of Love, War and Genius, as Written by Our Genetic Code by Sam Kean.  Kean also wrote The Disappearing Spoon about the elements of the periodic table.   This book is about DNA and genetics.  About how your genes can be your gift and your curse, what we've learned and how we learned about genes and DNA, and how much is unknown.  Did you know that humans appear to have less than 25000 genes?  and tomatoes have over 31000?  isn't that weird?  

Kean talks about fruit flies, Watson and Crick, cloning, Darwin, birth defects, Mendel, the Human Genome Project, Paganini,  Thomas Jefferson's descendents, and much more. a lot of topics to cover in 350 pages plus endnotes (read them, they're funny).  Kean's a good writer and turns these various topics into a compelling story, a great narrative of science

 Like science history?  pick this one up, if you have some basic knowledge.  I don't know if it is quite basic enough for someone who knew nothing about genetics and biology to really understand it.  I recommend it, especially if you read and enjoyed The Disappearing Spoon or anything by Mary Roach.  a 6.


tctaaagaggctaactaattacgcgaacttaggttacacttagtacaagtcattagtctgtgggaccacaggtta

Comments

Post a Comment

Popular posts from this blog

Yet Another Best of the Year Post

-
I am a little shocked that we've gotten to "end of the year post" time already.  I know everybody says this but this year really has passed quickly it seems, at least the fall has.  

As always, these are things that were new to ME this year, not necessarily published or released this year.  And not just 10 of things!

Books: 
The Dead in Their Vaulted Arches by Alan BradleyThree Parts Dead by Max GladstoneThe Death of Bees by Lisa O'DonnellFive Days at Memorial by Sheri FinkMy Real Children by Jo WaltonLife After Life by Kate AtkinsonThe Lucifer Box series by Mark GatissThe Silkworm by Robert GalbraithPale Fire by Vladimir NabokovHard-Boiled Wonderland and the End of the World by Haruki MurakamiKindred by Octavia ButlerThe Bone Clocks by David MitchellNight Film by Marissa PessiFever Pitch by Nick Hornby
Graphic Novels:
March, Book 1 by John Lewis, Andrew Aydin and Nate PowellSaga, Volume 3 by Brian K. Vaughn and Fiona StaplesSex Criminals Volume 1: One Weird Trick by Mat…
Read more

Fahrenheit 451

-
Sometimes I really want to smack myself. In the head, relatively hard, to leave bruises. Usually it happens when I either realize something that I should have figured out long before or when I read something and I am upset about what I've been missing.

That happened last night when I finished Fahrenheit 451 by Ray Bradbury. How could I get through 20 years of serious reading life and not have read this? How did I manage to go through the last few years without such a relevant, modern book in my mental arsenal? I want to grab everyone I know and make them read it. I don't want to rehash the plot as I think most people know the gist of it but what got me isn't the fact that it was about censorship, it is really about people participating in their own slavery. The long speeches by Montag's boss and his friend Faber really crystalize how a people could be led to become robots. How Bradbury predicted the mass media culture and faux-news environment in 1953 is beyond me. …
Read more

Pride and Prejudice

-
I watched the 2005 version of Pride and Prejudice last night. Very pretty but I thought the music was way overdone. Jena Malone had Lydia just right, the woman who played Jane was lovely, Bingley and Mr. Wickham and the Bennett parents were great too. So, the big two. Keira Knightly has some very prominent collarbones. I kept looking at that. on the movie itself, she is a good actress and she conveys her feelings and thoughts so well with her expressions. Matthew Macfadyen plays Mr. Darcy, very stoic and British stiff-upper lip type. and, of course, tall, dark and handsome.
So this one is a 7, counts for the Everything Austen Challenge, and is now on my wishlist for Christmas.

Read more