The Violinist's Thumb

I finished The Violinist's Thumb: And Other Tales of Love, War and Genius, as Written by Our Genetic Code by Sam Kean.  Kean also wrote The Disappearing Spoon about the elements of the periodic table.   This book is about DNA and genetics.  About how your genes can be your gift and your curse, what we've learned and how we learned about genes and DNA, and how much is unknown.  Did you know that humans appear to have less than 25000 genes?  and tomatoes have over 31000?  isn't that weird?  

Kean talks about fruit flies, Watson and Crick, cloning, Darwin, birth defects, Mendel, the Human Genome Project, Paganini,  Thomas Jefferson's descendents, and much more. a lot of topics to cover in 350 pages plus endnotes (read them, they're funny).  Kean's a good writer and turns these various topics into a compelling story, a great narrative of science

Like science history?  pick this one up, if you have some basic knowledge.  I don't know if it is quite basic enough for someone who knew nothing about genetics and biology to really understand it.  I recommend it, especially if you read and enjoyed The Disappearing Spoon or anything by Mary Roach.  a 6.


tctaaagaggctaactaattacgcgaacttaggttacacttagtacaagtcattagtctgtgggaccacaggtta