The Violinist's Thumb
Kean talks about fruit flies, Watson and Crick, cloning, Darwin, birth defects, Mendel, the Human Genome Project, Paganini, Thomas Jefferson's descendents, and much more. a lot of topics to cover in 350 pages plus endnotes (read them, they're funny). Kean's a good writer and turns these various topics into a compelling story, a great narrative of science
Like science history? pick this one up, if you have some basic knowledge. I don't know if it is quite basic enough for someone who knew nothing about genetics and biology to really understand it. I recommend it, especially if you read and enjoyed The Disappearing Spoon or anything by Mary Roach. a 6.
tctaaagaggctaactaattacgcgaacttaggttacacttagtacaagtcattagtctgtgggaccacaggtta
Comments
Post a Comment